GENESV
Gene Sequence Variability Analysis

Service Description

The GeneSV service is under construction.


GENESV service has been designed to facilitate calculation of sequence alignmets between a given sequence (query) and a library of provided genomic sequences.

For GENESV processing all sequences (query sequence and a library) should be nucleic acid sequences entered in FASTA format.

   A sequence in FASTA format begins with a single-line description, followed by 
   lines of sequence data. The description line is distinguished from the sequence
   data by a greater-than (">") symbol in the first column (see an example below):

>gi|9626685|ref|NC_001477.1| Dengue virus 1
AGTTGTTAGTCTACGTGGACCGACAAGAACAGTTTCGAATCGGAAGCTTGCTTAACGTAGTTCTAACAGT
TTTTTATTAGAGAGCAGATCTCTGATGAACAACCAACGGAAAAAGACGGGTCGACCGTCTTTCAATATGC
TGAAACGCGCGAGAAACCGCGTGTCAACTGTTTCACAGTTGGCGAAGAGATTCTCAAAAGGATTGCTTTC
AGGCCAAGGACCCATGAAATTGGTGATGGCTTTTATAGCATTCCTAAGATTTCTAGCCATACCTCCAACA
GCAGGAATTTTGGCTAGATGGGGCTCATTCAAGAAGAATGGAGCGATCAAAGTGTTACGGGGTTTCAAGA
AAGAAATCTCAAACATGTTGAACATAATGAACAGGAGGAAAAGATCTGTGACCATGCTCCTCATGCTGCT
GCCCACAGCCCTGGCGTTCCATCTGACCACCCGAGGGGGAGAGCCGCACATGATAGTTAGCAAGCAGGAA
AGAGGAAAATCACTTTTGTTTAAGACCTCTGCAGGTGTCAACATGTGC